Assignment 1 Prostate Cancer Risk assessment

COMP 204 - Assignment 1

Important instructions:

• For each question, start off from the Python given to you. Do not change its name.
• Do not use any modules or any pieces of code you did not write yourself
• For each question, your program will be automatically tested on a variety of test cases, which will account for 75%
of the mark. To be considered correct, your program should print out exactly and only what the question specifies.
Do not add extra text, extra spaces or extra punctuation. Do not ask the user to enter any other information than
what is needed.
• For each question, 25% of the mark will be assigned by the TA based on (i) your appropriate naming of variables;
(ii) commenting of your program; (iii) simplicity of your program (simpler = better).
1
1 Prostate Cancer Risk assessment (20 points)
Required knowledge: Conditionals and nested conditionals.
Download the prostateCancerRisk.py Python program on MyCourses.
The risk for a man to develop prostate cancer can be estimated based on their family history, their ethnicity, and two
genetic factors: the number of GCC repeats in the androgen receptor (AR) gene and the genotype of the CYP3A4 gene.
The decision tree below describes a strategy that could be used by a male to assess his level of risk. Based on this decision
tree, write a Python program that asks a series of questions to the user to determine their level of risk. Your program
should only ask the questions that are necessary. In your program, use exactly the text used in the decision tree. If the
answer provided by the user is invalid (see below), the program should print Invalid, stop asking further questions, and
print nothing else. At the end, your program should print either Low risk, Medium risk, or High risk, based on the user’s
answers, or Invalid.
Family    history?    
AR_GCC    repeat        
copy    number?    
European    ancestry?    
<16    
Yes    
Medium    risk    
Low    risk    
Low    risk    
Mixed    
No    
=16    
High    risk    
AR_GCC    repeat    
copy    number?    
CYP3A4    
haplotype?    
AA    
High    risk    
No    
<16     =16     GA    or    AG    or    GG    
CYP3A4    
haplotype?    
CYP3A4    
haplotype?    
Medium    risk    
AA    
High    risk    
GA    or    AG    or    GG    
Low    risk    
AA    
High    risk    
GA    or    AG    or    GG    
Yes    
Disclaimer: Do not use this test to self-assess your risks of prostate cancer. Talk to a doctor instead!
Here are a couple of examples of the way your program should behave. The text in italics are the user’s answers.
Family history? Yes
European ancestry? No
AR GCC repeat copy number: 19
Medium risk
Family history? No
Low risk
Family history? Yes
European ancestry? Mixed
AR GCC repeat copy number: 12
CYP3A4 haplotype: GA
High risk
Family history? Maybe
Invalid
Family history? Yes
European ancestry? Mixed
AR GCC repeat copy number: Twelve
Invalid
The following answers should be the only ones considered valid:
Family history? Yes or No
European ancestry? Yes or No or Mixed
2
AR GCC repeat copy number: Any integer greater or equal to 0
CYP3A4 haplotype: AA or AG or GA or GG
2 Blood type compatibility (20 points)
Required knowledge: Conditionals and nested conditionals.
Download the bloodTypes.py Python program on MyCourses.
Human blood types are characterized by the antigen group (either A, B, AB, or O), and by the rhesus (either positive
or negative). Blood transfusions between a donor and a recipient are only possible if the donor is compatible with the
recipient. The rules of antigen compatibility are described here:
https://www.hema-quebec.qc.ca/sang/savoir-plus/groupes-sanguins.en.html
For example, A can give to AB, but AB cannot give to B. Rhesus rules are simple: Rh- can give to both Rh- and Rh+,
but Rh+ can only give to Rh+.
Complete this Python program to make it print one of three possible words, and nothing else: Compatible or Incompatible or Invalid. Your program should print Compatible if the donor is compatible with the recipient. It should print
Incompatible if the donor is not compatible with the recipient. It should print Invalid if one or both of the blood types
entered by the user is invalid. Valid blood types are the strings: O+, O-, A+, A-. B+, B-, AB+, AB-.
3 DNA sequences (20 points)
Required knowledge: Loops, conditionals, string manipulations
Download the nucleotideComposition.py Python program on MyCourses.
Write a program that counts the number of A, C, G, T in a DNA sequence. Your program should ask the user to enter
a DNA sequence made of A, C, G, and T. It should then print four numbers, corresponding to the number of A’s, C’s,
G’s, and T’s, separated by spaces, and nothing else. For example, given the sequence AGGCAG, your program should
print 2 1 3 0. If the input sequence contains any character other than A, C, G, or T (in capital letters), your program
should not print out any number, but instead print out the word Invalid.
4 Number of cut sites for restriction enzyme (20 points)
Required knowledge: Loops, conditionals, string manipulations, accumulator
Download the DNARestriction.py Python program on MyCourses.
A restriction enzyme is a protein that recognizes specific DNA subsequences and cuts the DNA at those positions. For
example, the HinDIII restriction enzyme cuts DNA whenever it encounters the 6-nucleotide pattern AAGCTT. Write a
program that asks the user to enter a DNA sequence and the cut-site sequence of a restriction enzyme, and counts the
number of cut sites that will result from the digestion of the given DNA sequence with that enzyme. For example:
Given sequence AAGCGATCGACAAGCTTGCAGAAAGCTTCA and cut-site AAGCTT, your program should print 2.
Given sequence AAGCGATCGACAAGCTTGCAGAAAGCTTCA and cut-site AAGC, your program should print 3.
Given sequence CAGCGAGCAGCAGAC and cut-site TTAG, your program should print 0
Given sequence ACACACACACACACA and cut-site ACAC, your program should print 6
You can assume that all sequences provided as input are valid, so you do not need to check their validity.
5 Translation of RNA sequence to amino acid sequence (20 points)
Required knowledge: Loops, conditionals, string manipulations, accumulator
Download the mRNATranslation.py Python program on MyCourses.
Write a program that asks the user to enter a messenger RNA sequence and that then calculates and prints the
length of the protein sequence, measured in number of amino acids, that is encoded by the given mRNA. Refer to
3
https://www.nature.com/scitable/topicpage/translation-dna-to-mrna-to-protein-393 to refresh your memory
about RNA translation. We will work under the (sometimes incorrect) assumption that the ribosome recognizes as the
start codon the first AUG nucleotide triplet it encounters. From there it translates the sequence codon by codon, until it
encounters an in-frame stop codon (UAA, UAG, or UGA). You can assume that the sequence will always include a start
codong and an in-frame stop codon.
Here are some examples of mRNA sequences and the length of the encoded protein:
AUGUGA: 1
ACCUAUGACGUCCUAAGCAGUUUGACG: 3
ACCUAUGAUAACCUAAGCAGUUUGACG: 3
AUGAUGAUGAUGAUGUGAUGAUGAUGA: 5
Your program must either print a single integer corresponding to the length of the amino acid sequence encoded.
4